pcw57 mcs1 p2a mcs2 blast (Addgene inc)

Addgene inc is a verified supplier

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Addgene inc pcw57 mcs1 p2a mcs2 blast
Pcw57 Mcs1 P2a Mcs2 Blast, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 43 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcw57+mcs1+p2a+mcs2+blast/pCW57-MCS1-P2A-MCS2+(Blast)+(Plasmid+%2380921)/10__1038_slash_s41467___026___77961___8-401-39-41
Average 93 stars, based on 43 article reviews

pcw57 mcs1 p2a mcs2 blast - by Bioz Stars, 2026-11

93/100 stars

Images

Over Expression:

Article Title: Gα12/13 deficiency attenuates obesity-associated adipose tissue inflammation and promotes energy expenditure
Article Snippet: Each sgRNAsequences forGna12 (TGTTGTCGAAGATGGTGTCG) and Gna13 (CTTGGATAAACTTGGAGTAC) were cloned into pLentiCRISPRv2 (Addgene, #52961) and pLentiCRISPRv2-Blast (Addgene, #83480) using BsmBIv2 (NEB). .. For Gα12 and Gα13 overexpression, a codon-optimized murine Gα12 and Gα13, their constitutively active mutants (Gα12_ Q229L and Gα13_ Q226L)19,23,40, as well as human Gα12 and Gα13 constructs, were synthesized and subcloned into pcDNA3.1 (Thermo-Fisher), pCW57.1 (Addgene #41393) or pCW57-MCS1-P2A-MCS2 (Blast) (Addgene #80921). .. Lentiviral particles were produced by co-transfecting HEK293T cells with pMD2.G (Addgene, #12259), psPAX2 (Addgene, #12260), and the respective lentiviral transfer plasmid constructs in a 1:3:4 ratio using the JetPrime Kit (Polyplus, 114-15).

Construct:

Article Title: Stalled translation by mitochondrial stress upregulates a CNOT4-ZNF598 ribosomal quality control pathway important for tissue homeostasis.
Article Snippet: .. The GFP-P2A-FLAG-K(AAA)20-P2A-mKate2 construct was modified based on GFP-P2A-FLAG-K(AAG)20-P2A-mCherry (105689, Addgene), and inserted into pCW57-MCS1-P2A-MCS2 (Blast) (80921, Addgene). .. For MTS (Mitochondrial targeting sequence)-GFP-K(AAA)20-P2AmKate2 construction, the GFP-P2A-FLAG fragment was removed from GFP-P2A-FLAG-K(AAA)20-P2A-mKate2 plasmid, and the GFP fragment and MTS sequence derived from the first 29 AA of cytochrome c oxidase subunit 8A (COX8A) were inserted into the digested construct by using Gibson Assembly HiFi Master Mix (A46627, Invitrogen).

Article Title: Flower dependent trafficking of lamellar bodies facilitates maturation of the epidermal barrier.
Article Snippet: .. pCW57-MCS1-P2A-MCS2-Blast (Addgene 80921) was used as a base vector to construct all lentiviral TetON constructs. .. In short, cell culture inserts in a 24 wells carrier plate (Nunc, Thermo Fisher Scientific, 141002) were coated using 100 μg/mL rat tail collagen (Sigma–Aldrich, C3867) for 1 h at 4 °C.

Synthesized:

other:

Article Title: Metabolic constraint of human telomere length by nucleotide salvage efficiency
Article Snippet: RNA was then DNase treated to remove genomic DNA with the Turbo DNase Kit according to the manufacturer’s protocol (Thermo Fisher).

Article Title: SPT5 regulates RNA polymerase II stability via Cullin 3-ARMC5 recognition.
Article Snippet: Cells used in this study tested negative for mycoplasma using PCR- based universal mycoplasma detection kit [American Type Culture Collection (ATCC), catalog no. 30- 1012K].

Modification:

Plasmid Preparation:

Article Title: Metabolic constraint of human telomere length by nucleotide salvage efficiency.
Article Snippet: pXPR_011 was a gift from J. Doench and D. Root (plasmid 59702; Addgene) pLX304 was a gift from D. Root (plasmid 25890; Addgene) psPAX2 was a gift from D. Trono (plasmid 12260; Addgene) pMD2.G was a gift from D. Trono (plasmid 12259; Addgene) pBS U3-hTR-500 was a gift from K. Collins (plasmid 28170; Addgene). pCDNA-3xHA-hTERT was a gift from S. Artandi (plasmid 51637; Addgene). pmaxGFP was purchased from Lonza pHIV7/SF-U3-TER-500 was previously described in ref. 60 pHIV7/SF-U3-TER-500 G319A was previously described in ref. 30 pcw57.1 TERT Puro was a gift from C. Reilly63 popen-dromedNK was a gift from Drew Endy & Jennifer Molloy & FreeGenes Project (plasmid 165579; Addgene) pCW57.1 was a gift from David Root (plasmid 41393; Addgene) pCW57-MCS1-P2A-MCS2 (Blast) was a gift from Adam Karpf (plasmid 80921; Addgene). .. pXPR_011 was a gift from J. Doench and D. Root (plasmid 59702; Addgene) pLX304 was a gift from D. Root (plasmid 25890; Addgene) psPAX2 was a gift from D. Trono (plasmid 12260; Addgene) pMD2.G was a gift from D. Trono (plasmid 12259; Addgene) pBS U3-hTR-500 was a gift from K. Collins (plasmid 28170; Addgene). pCDNA-3xHA-hTERT was a gift from S. Artandi (plasmid 51637; Addgene). pmaxGFP was purchased from Lonza pHIV7/SF-U3-TER-500 was previously described in ref. 60 pHIV7/SF-U3-TER-500 G319A was previously described in ref. 30 pcw57.1 TERT Puro was a gift from C. Reilly63 popen-dromedNK was a gift from Drew Endy & Jennifer Molloy & FreeGenes Project (plasmid 165579; Addgene) pCW57.1 was a gift from David Root (plasmid 41393; Addgene) pCW57-MCS1-P2A-MCS2 (Blast) was a gift from Adam Karpf (plasmid 80921; Addgene). .. TRACE assay experiments were quantified using ImageJ (Version 2.9.0/1.54 f) as follows: First, calculate the ratio (R) of signal above 5 kb (largely newly synthesized telomere) to below 5 kb (largely pre-existing telomere signal for TERC−/− 293 T cells) for each sample.

Article Title: Recruitment of BAG2 to DNAJ-PKAc scaffolds promotes cell survival and resistance to drug-induced apoptosis in fibrolamellar carcinoma
Article Snippet: .. pCW57-MCS1-P2A-MCS2 (Blast) , (Barger etal.) , Adam Karpf; Addgene Plasmid #80921. .. pMD2.G , Trono Lab (unpublished) , Didier Trono; Addgene Plasmid #12259.

Review